fli1 sirna  (Santa Cruz Biotechnology)

Journal: Scientific Reports

Article Title: FLI1 is associated with regulation of DNA methylation and megakaryocytic differentiation in FPDMM caused by a RUNX1 transactivation domain mutation

doi: 10.1038/s41598-024-64829-4

Figure Lengend Snippet: DNA methylation analysis of FPDMM-mimicking HPCs. ( a ) Overlaps of hypermethylated (left) and hypomethylated (right) CpGs between RUNX1 WT/R201Q (blue) and RUNX1 WT/Y287X (red) HPCs. ( b ) (Left) The known HOCOMOCO v11 binding motif for GABPA (top), FEV (middle), and ELF1 (bottom). (Middle and right) Distribution of ETS family TF-binding motif-enrichment. The X - and Y -axes show the distance from DMC (bp) and probability of TF-binding motifs, respectively. Solid lines are probabilities at ± 5 kb for hypermethylated DMCs in RUNX1 WT/R201Q (middle) and RUNX1 WT/Y287X (right) HPCs, and dashed lines are probabilities at ± 5 kb from randomly selected CpGs. Data that are significantly enriched ( E -value of the Fisher’s exact test < 0.05) and ranked in the top-20 of Fisher E -value rankings are presented. Blue: GABPA-binding motif, red: FEV-binding motif, and pink: ELF1-binding motif. ( c ) Expression of ELF1 (left) and FLI1 (right) in RUNX1 WT/R201Q (blue) and RUNX1 WT/Y287X (red) HPCs compared to wild-type cells, confirmed using qRT-PCR. The X -axis shows the target genes, and the Y -axis represents the fold-change. Data are presented as the mean ± SD of four biological replicates. Asterisks denote significant difference: * P < 0.05 and ** P < 0.01. ( d ) Distribution of enrichment for FLI1-binding sites, as determined by CUT&RUN sequencing for FLI1 in wild-type HPCs, showing the regions within ± 5 kb of the hypermethylated DMCs in RUNX1 WT/Y287X HPCs (red line). Gray line represents FLI1-binding site-enrichment at regions around randomly selected CpGs.

Article Snippet: FLI1 shRNA (sc-35384-SH) and control shRNA (sc-108060) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA).

Techniques: DNA Methylation Assay, Binding Assay, Expressing, Quantitative RT-PCR, Sequencing

Journal: Scientific Reports

Article Title: FLI1 is associated with regulation of DNA methylation and megakaryocytic differentiation in FPDMM caused by a RUNX1 transactivation domain mutation

doi: 10.1038/s41598-024-64829-4

Figure Lengend Snippet: Effect of FLI1 downregulation on megakaryocytic differentiation. ( a ) Confirmation of the expression of FLI1 in negative-control-knockdown (nc-KD, gray) and FLI1 -knockdown (FLI1-KD, yellow) HPCs compared with that in wild-type HPCs using qRT-PCR. The X -axis indicates the target genes, and the Y -axis indicates the fold-change. Data are presented as the mean ± SD of three biological replicates. Asterisks denote significant difference: * P < 0.05. ( b ) Representative plot for flow cytometric analysis of CD41 + CD42b + Mks per 20,000 negative-control-knockdown and FLI1 -knockdown HPCs. ( c ) Percentages of CD41 + CD42b + Mks per 20,000 negative-control-knockdown (nc-KD, gray) and FLI1 -knockdown (FLI1-KD, yellow) HPCs. Data are presented as the mean ± SD of three biological replicates. Asterisks denote significant difference: * P < 0.05.

Article Snippet: FLI1 shRNA (sc-35384-SH) and control shRNA (sc-108060) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA).

Techniques: Expressing, Negative Control, Knockdown, Quantitative RT-PCR

Journal: Scientific Reports

Article Title: FLI1 is associated with regulation of DNA methylation and megakaryocytic differentiation in FPDMM caused by a RUNX1 transactivation domain mutation

doi: 10.1038/s41598-024-64829-4

Figure Lengend Snippet: Rescue of deficient megakaryocytic differentiation in FPDMM-mimicking HPCs by FLI1 overexpression. ( a ) Schematic representation of the megakaryocytic differentiation method. FPDMM-mimicking iPSCs were transfected with a lentiviral vector containing the DOX-inducible FLI1 expression system. ( b ) Confirmation of the expression of FLI1 in Y287X-mock (red) and Y287X-FLI1 (orange) HPCs using qRT-PCR. Data are presented as the mean ± SD of six biological replicates. The asterisk denotes significant difference: * P < 0.05. ( c ) Percentages of CD41 + CD42b + Mks per 20,000 wild-type (WT, gray), Y287X-mock (red), and Y287X-FLI1 (orange) HPCs. Data are presented as the mean ± SD of six biological replicates. The asterisk denotes significant difference: ** P < 0.01 and ns, not significant.

Article Snippet: FLI1 shRNA (sc-35384-SH) and control shRNA (sc-108060) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA).

Techniques: Over Expression, Transfection, Plasmid Preparation, Expressing, Quantitative RT-PCR

Journal: Scientific Reports

Article Title: FLI1 is associated with regulation of DNA methylation and megakaryocytic differentiation in FPDMM caused by a RUNX1 transactivation domain mutation

doi: 10.1038/s41598-024-64829-4

Figure Lengend Snippet: Induction of DNA hypomethylation in FPDMM-mimicking HPCs by FLI1 overexpression. ( a ) Scatter plot showing the percent methylation scores of 1344 CpG sites between Y287X-mock and Y287X-FLI1 HPCs. The X - and Y -axes indicate percent methylation scores for Y287X-mock and Y287X-FLI1 HPCs, respectively. The solid line represents equal percent methylation scores between samples, and dashed lines represent differences in percent methylation scores of > 25%. ( b ) Percentage point distributions of 1344 CpG sites between Y287X-FLI1 and Y287X-mock HPCs (FLI1-mock, orange) and of the same number of CpG sites randomly selected among CpG sites covered by sequencing (random, gray). Data are presented as the mean ± SD. The asterisk denotes significant difference: *** P < 0.001. ( c ) Distributions of enrichment for FLI1-binding sites, as determined by CUT&RUN sequencing for FLI1 in Y287X-mock (left) and Y287X-FLI1 HPCs (right), showing the regions within ± 5 kb of the hypermethylated DMCs in RUNX1 WT/Y287X HPCs (red lines). Gray lines represent FLI1-binding site-enrichments at regions around randomly selected CpGs.

Article Snippet: FLI1 shRNA (sc-35384-SH) and control shRNA (sc-108060) were purchased from Santa Cruz Biotechnology (Dallas, TX, USA).

Techniques: Over Expression, Methylation, Sequencing, Binding Assay

Journal: Cell Death & Disease

Article Title: Overexpressed Gαi1 exerts pro-tumorigenic activity in nasopharyngeal carcinoma

doi: 10.1038/s41419-023-06308-8

Figure Lengend Snippet: The JASPAR database predicted the potential transcription factors of Gαi1 ( A ). pNPC-1 cells were transfected with the described siRNAs targeting different transcription factors or scramble non-sense siRNA (siC) for 48 h, expression of Gαi1 mRNA was examined ( B ). pNPC-1 cells with the lentiviral ZNF384 shRNA (shZNF384), the lentiviral CRISPR-ZNF384-KO construct (“koZNF384”), the scramble control shRNA plus CRISPR/Cas9 control construct (“shC+Cas9-C”), the lentiviral ZNF384-expressing construct (oeZNF384) or the empty vector (“Vec”) were established, expression of listed mRNAs and proteins was tested ( C – F ). Chromosome IP (ChIP) assay results showed the relative levels of ZNF384-bound Gαi1 promoter in the described NPC tumor tissues (“T”) and matched adjacent normal nasopharynx epithelial tissues (“N”) ( G ) as well as in the listed primary NPC cells and primary human nasal epithelial cells (HNEpC) ( H ). “Ctrl” stands the parental control cells. pNPC-1 cells with the lentiviral ZNF460 shRNA (“shZNF460”) or the scramble control shRNA (“shC”) were established, expression of listed proteins was tested ( I ). The expression of listed proteins in NPC tumor tissues (“T”, n = 20) and matched adjacent normal nasopharynx epithelial tissues (“N”, n = 20) was shown, with results quantified ( J ). The numerical values were mean ± standard deviation (SD). * P < 0.05 versus “siC” ( B ). * P < 0.05 versus “Ctrl”/“Vec” cells ( C - F ). * P < 0.05 versus “shC” ( I ).* P < 0.05 versus “N” tissues or pHNEpC-1 cells ( G, H , J ). Experiments in this figure were repeated five times, with similar results obtained.

Article Snippet: Verified siRNAs against different transcription factors (ZNF460, ZNF384, EWSR1-FLI1, ZNF680, and EIf5) were provided by Genechem (Shanghai, China) and each (at the concentration of 200 nM) was individually transfected to NPC cells using Lipofectamine 3000.

Techniques: Transfection, Expressing, shRNA, CRISPR, Construct, Control, Plasmid Preparation, Standard Deviation

Journal: Cancer Medicine

Article Title: Screening for DAX1 / EWS‐FLI1 functional inhibitors identified dihydroorotate dehydrogenase as a therapeutic target for Ewing's sarcoma

doi: 10.1002/cam4.5741

Figure Lengend Snippet: EWS‐FLI1‐related gene expression after treatment with DAX1 inhibitors and knockdown of FLI1 in A‐673 cells. (A) A‐673 cells were treated with siRNA of FLI1 (siFLI‐1, siFLI‐2) or control siRNA (control siRNA1, control siRNA2) for 24 h, and EWS‐FLI1‐related genes were analyzed (details of siRNA are shown in Table ). The gene expression was normalized by the GAPDH expression and normalized by the mean of control siRNA‐treated samples. Each bar represents the mean of duplicate measurements. (B) A‐673 cells were treated with PTC299 at 1000 nM for 48 h, and EWS‐FLI1‐related genes were analyzed. Gene expression was normalized by the GAPDH expression and by DMSO‐treated samples. Each bar represents the mean of duplicate measurements.

Article Snippet: RNA interference: small hairpin RNA (shRNA) targeting human DAX1 (5′‐TGCAGTGCGTGAAGTACATTC‐3′, TRCN0000413033) and small interfering RNA (siRNA) targeting human FLI1 (5′‐CGATCAGTAAGAATACAG‐3′) were purchased from Sigma‐Aldrich. shDAX1 was inserted into pLKO.1 (Sigma‐Aldrich).

Techniques: Expressing

Journal: Cancer Medicine

Article Title: Screening for DAX1 / EWS‐FLI1 functional inhibitors identified dihydroorotate dehydrogenase as a therapeutic target for Ewing's sarcoma

doi: 10.1002/cam4.5741

Figure Lengend Snippet: Influence of DHODH overexpression on Ewing's sarcoma cell growth and the EWS‐FLI1‐regulated gene expression. (A) pcDNA3.1hygro(+)‐hDHODH was transfected into A‐673 cells. The A‐673 cells with DHODH or control A‐673 cells were treated with indicated concentrations of PTC299 and KF20444 for 72 h, and cell viability was measured. Each plot represents the mean of triplicate measurements. (B) A‐673 cells with or without uridine (100 μM) were treated with indicated concentrations of PTC299 for 72 h, and cell viability was measured. Each plot represents the mean of triplicate measurements. (C) A‐673 cells with or without uridine (100 μM) were treated with PTC299 and KF20444 at 1000 nmol/L for 48 h, and the EWS‐FLI1‐related gene expression was evaluated. The expression was normalized by GAPDH and by DMSO‐treated samples. (D) KJMGER8/pAGal9p4‐hDAX1 cells with or without uridine (100 μM) were treated with indicated concentrations of PTC299 and K‐733 overnight, and the luciferase activity was measured. Each plot represents the mean of quadruplicate measurements.

Article Snippet: RNA interference: small hairpin RNA (shRNA) targeting human DAX1 (5′‐TGCAGTGCGTGAAGTACATTC‐3′, TRCN0000413033) and small interfering RNA (siRNA) targeting human FLI1 (5′‐CGATCAGTAAGAATACAG‐3′) were purchased from Sigma‐Aldrich. shDAX1 was inserted into pLKO.1 (Sigma‐Aldrich).

Techniques: Over Expression, Expressing, Transfection, Luciferase, Activity Assay

Journal: Cancer Medicine

Article Title: Screening for DAX1 / EWS‐FLI1 functional inhibitors identified dihydroorotate dehydrogenase as a therapeutic target for Ewing's sarcoma

doi: 10.1002/cam4.5741

Figure Lengend Snippet: K‐733 exerts an anti‐tumor effect in mice bearing Ewing's sarcoma. (A) Plasma concentration‐time profiles of K‐733 in mice after a single oral administration of K‐733. Each plot represents the mean of duplicate measurements. (B) Antitumor effect of K‐733 on A‐673 cells. Indicated doses of K‐733 were orally administered once daily for 14 days. Each plot represents the mean of n = 5 and SE. C, Influence of K‐733 on EWS‐FLI1‐related genes. Tumors were sampled after 14 days oral administration of K‐733. Each plot represents the mean of n = 5 and SE. (D, E, F) Antitumor effects of K‐733 on TC‐71, SK‐ES133, and CADO‐ES‐1 cells. Indicated doses of K‐733 were orally administered once daily for 14 days. Each plot represents the mean of n = 5 and SE.

Article Snippet: RNA interference: small hairpin RNA (shRNA) targeting human DAX1 (5′‐TGCAGTGCGTGAAGTACATTC‐3′, TRCN0000413033) and small interfering RNA (siRNA) targeting human FLI1 (5′‐CGATCAGTAAGAATACAG‐3′) were purchased from Sigma‐Aldrich. shDAX1 was inserted into pLKO.1 (Sigma‐Aldrich).

Techniques: Concentration Assay

Journal: Journal of Translational Medicine

Article Title: FLI1 regulates radiotherapy resistance in nasopharyngeal carcinoma through TIE1-mediated PI3K/AKT signaling pathway

doi: 10.1186/s12967-023-03986-y

Figure Lengend Snippet: FLI1 binds to TIE1 promoter and activates TIE1 transcription in NPC cells. A Heatmap showing differential gene expression between CNE1-OE cells and CNE1-VEC cells, 5-8F-shRNA cells and 5-8F-NC cells, as is analyzed by RNA-seq. B – C Correlation analysis between FLI1 and TIE1 in GEO database B and TCGA database C . D – E Western blot C and RT-qPCR D analysis of TIE1 protein and mRNA level in FLI1 overexpression and knockdown NPC cells. F Dual-luciferase reporter assays were used to evaluate TIE1 promoter activity in NPC cells transiently transfected with control vector (VEC), FLI1 overexpression plasmid (FLI1), negative control siRNA (NC) and FLI1-specific siRNA (siFLI1). G – H CNE1 and SUNE1 cells were transiently transfected with vector (VEC) and Flag-FLI1 overexpression plasmid (Flag-FLI1). ChIP-PCR G and ChIP-qPCR H assays of TIE1 promoter region were conducted with Flag or control IgG antibody in CNE1 Flag-FLI1 and SUNE1 Flag-FLI1 cells. I CNE1-VEC and CNE1-FLI1 cells were transiently transfected with siTIE1 or control siRNA. 5-8F-NC and 5-8F-shFLI1 cells were transiently transfected with TIE1 or empty vector plasmids. Cells were seeded at the density of 200, 400, 800 and 1000 cells for 0 Gy, 1 Gy, 2 Gy and 4 Gy IR dose. Colony formation assays and survival fraction curve analysis were employed to assess cell survival at 10–14 days after exposure to indicated IR dose. Data in E , F , H and I are presented as mean ± SD (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001; ns, not significant (Student’s t-test). Source data are provided as a Source Data file

Article Snippet: The siRNAs targeting FLI1 and TIE1 were purchased from RiboBio (Guangzhou, GD, China).

Techniques: Gene Expression, shRNA, RNA Sequencing, Western Blot, Quantitative RT-PCR, Over Expression, Knockdown, Luciferase, Activity Assay, Transfection, Control, Plasmid Preparation, Negative Control, ChIP-qPCR

Journal: Journal of Translational Medicine

Article Title: FLI1 regulates radiotherapy resistance in nasopharyngeal carcinoma through TIE1-mediated PI3K/AKT signaling pathway

doi: 10.1186/s12967-023-03986-y

Figure Lengend Snippet: FLI1 regulates TIE1-mediated PI3K/AKT signaling pathway in NPC cells. A KEGG pathway analysis of genes regulated by FLI1 in CNE1 and 5-8F cells. PI3K/AKT pathway was among the significant pathways. B Western blot analysis of TIE1, PI3K, p-PI3K, AKT, p-AKT (Thr308) and p-AKT (Ser473) in CNE1 cells with FLI1 overexpression and 5-8F cells with FLI1 knockdown. C CNE1-VEC and CNE1-FLI1 cells were transiently transfected with siTIE1 or control siRNA. 5-8F-NC and 5-8F-shFLI1 cells were transiently transfected with TIE1 or empty vector plasmids. Western blot assays were performed to assess the protein level of TIE1, PI3K, p-PI3K, AKT, p-AKT (Thr308) and p-AKT (Ser473). D – E CNE1-VEC and CNE1-FLI1 cells were treated with IR, a PI3K inhibitor BKM120 (3 μM) and an AKT inhibitor MK2206 (3 μM). Colony formation assays and survival fraction curve analysis D were employed to assess cell survival at 10–14 days after exposure to indicated IR dose. Cell apoptosis E was determined by Annexin V/PI double-staining assays at 48 h after indicated treatment. Data in D and E are presented as mean ± SD (n = 3). ** p < 0.01; ns, not significant (Student’s t-test). Source data are provided as a Source Data file

Article Snippet: The siRNAs targeting FLI1 and TIE1 were purchased from RiboBio (Guangzhou, GD, China).

Techniques: Western Blot, Over Expression, Knockdown, Transfection, Control, Plasmid Preparation, Double Staining

Journal: Journal of Translational Medicine

Article Title: FLI1 regulates radiotherapy resistance in nasopharyngeal carcinoma through TIE1-mediated PI3K/AKT signaling pathway

doi: 10.1186/s12967-023-03986-y

Figure Lengend Snippet: FLI1 induces radioresistance in the NPC xenograft mouse model. A – B Assessment of FLI1 levels on radiotherapy efficacy in NPC xenografts. FLI1-overexpressing (FLI1) and empty vector (VEC)-transfected CNE1 cells A or FLI1-knockdown (shFLI1) and negative control (NC) 5-8F cells B were implanted into BALB/c nude mice, which were exposed to IR or not. Tumor volume and weight of the excised tumors were measured (left, excised tumors; middle, tumor volume; right, tumor weight). C – D Representative images of IHC staining and IHC scores for FLI1, TIE1 and cleaved caspase-3 in the excised tumors. Scale bars = 100 μm. ** p < 0.01, **** p < 0.0001; ns not significant (Student’s t-test). Source data are provided as a Source Data file

Article Snippet: The siRNAs targeting FLI1 and TIE1 were purchased from RiboBio (Guangzhou, GD, China).

Techniques: Plasmid Preparation, Transfection, Knockdown, Negative Control, Immunohistochemistry

Journal: Journal of Translational Medicine

Article Title: FLI1 regulates radiotherapy resistance in nasopharyngeal carcinoma through TIE1-mediated PI3K/AKT signaling pathway

doi: 10.1186/s12967-023-03986-y

Figure Lengend Snippet: FLI1 expression is positively correlated with TIE1 expression and high FLI1-TIE1 levels predict poor clinical outcomes in NPC patients. A Representative images of IHC staining of TIE1 protein expression in 137 NPC tissues (a, no brown particle staining; b, light brown particles; c, moderate brown particles; d, dark brown particles). Scale bars = 100 μm. B – D Kaplan–Meier analysis of the overall survival B , local recurrence free survival C and progress free survival D of 137 NPC patients based on TIE1 expression. The p values were analyzed by log-rank test. E The correlation analysis between FLI1 expression and TIE1 expression. Pearson chi-square analysis was used to determine the correlation

Article Snippet: The siRNAs targeting FLI1 and TIE1 were purchased from RiboBio (Guangzhou, GD, China).

Techniques: Expressing, Immunohistochemistry, Staining